top of page

MY EXPERIENCE AS A CHRISTIAN AND CREATIONIST ON UNIVERSITY ACADEMIC STAFF

From my youth until the age of 36, when I became a fully committed Christian, Christmas, Easter and my early encounter with the love of Jesus at the age of eight, were always somewhere but only dimly in the back of my mind. I always wished that the stories of the Bible were true, but as I entered the education system at the age of eleven in Australia I became more and more convinced as the years advanced that the Bible was nothing more than wishful thinking and a bunch of fables. If only the stories about Jesus had been true.

 

I was appointed to faculty in 1971 but a few years later everything changed dramatically. I was converted miraculously in 1976. I had loved my work at University and treated my office as home away from home. University colleagues were among my best friends, until they despised me when I became a very vocal creationist.

 

However, as a new creation in Jesus, I began to spend more time at home  instead of always being at work later than most, yet I was also absent a lot from home, spending time at church, reading the bible and evolutionary literature voraciously. I did everything I could to honour God, some things wisely and some things unwisely, to bring my family to salvation. I began to give numerous talks on creation including one in the Sydney Opera House in Australia, albeit still quite inexperienced and drawing some criticism from other creationists.

 

I grew rapidly in biblical and scientific truths. I was dismayed how speculative texts and scientific papers were on the origin of life and on the evolution of complex organs. Organs and appendages like feathers and wings, vision, reproduction, the digestive and circulatory systems, and the most complex of all, the step-wise and ordered development of  a fully mature organism from a single microscopic egg,  were glibly explained away by time, chance and mutations permitting God no credit. Yet, it is blatantly evident for all to see, that it is the pre-programmed information on the DNA in every living cell that allows development to take place in orderly fashion. The major steps of development are pre-programmed in every sense of the word. Pre-programmed by whom? Every program needs a programmer! This is surely self-evident. 

​

Cells are dependent on information existing in the very long strings of DNA within their cells which bear the code of life using only the four 'biochemical bases/letters', A, T, G and C. Where does all this complex information come from?

 

Human DNA contains about 3,200,000,000 of these letters in complementary pairs running along the famous double helix as evident in the next image.  Genes come in duplicates, thereby providing redundancy that protects us from having even more genetic disorders than we already have, in 23 pairs of chromosomes within the nucleus of all our cells. Only mature red blood cells contain no DNA.

 

Each of the chromosomes contains hundreds to thousands of genes. They carry the instructions for making proteins that build and develop our bodies so very precisely. The co-ordination and timing of the countless activities in each cell boggles the mind. It already exists in 'written form' in the single fertilized egg cell in our mother's womb.

​

The biggest mystery of biological life is in the area of  developmental biology;  How does the molecular machinery in every cell know which particular assemblage of genes to express so that eyes don’t accidentally form on our knees and visa versa. There are hormonal and positional signals that determine which genes the cell is  to express, all controlled by the DNA within each cell. All these essential processes imply an enormous information content inherent in the DNA of a single fertilized egg cell within the womb.

 

The written DNA code is so simple, and yet is so utterly complex! Here is a question for you to consider if you were a cell. How would you decipher this string of the DNA code that is within you?

AGGGCCTTAAAAGCGCGCTTATATTTCGCGTGTAGGCAAATTTTGCGCGTGTGCT AGTCTAG GTAGGGATTTCGCTCAGTGGGCCCCGGGCCTTAAAATCTCGTGAAACTTAGAGAGACCGTTTA…which continues on for another 3,199,999,877 letters or so! Imagine if you were a cell in the eye asking yourself, 'Now where should I start to read the master gene in my DNA for eyes? Hmmnn, let’s see. Maybe here? No, that wasn't right.  Let’s try here.' Can you imagine the enormity of the problem for a newly born cell in the eye, trying to play its intended role in eye tissue?

  'The fool says in his heart, there is no God'   (Psalms 14:1)

​

THE DNA CODE

​

Though the DNA code has the appearance of being simple, it is more complex than people can imagine.  In living tissues DNA is the blueprint or instruction manual of the organism. It can reproduce itself as each cell divides and because of its stability a cell can always refer to its own manual whenever the need arises. However, cells can not use DNA directly to make anything. The DNA code has first to be changed to an RNA code before cells can use it to make proteins. RNA differs chemically from DNA, but is so unstable that the cell only makes RNA when its needed to make a particular protein. For example stress proteins, or proteins required for growth, etc.

 

To make any sense the code on the long string of DNA has to be read the four letters A, T, C and G, in groupings of three once it has been transferred to an  RNA code. The difference between the DNA code and RNA code, is that the machinery (the ribosomes)  that makes proteins cannot read the 'T' (Thyamine) of a DNA code. In RNA every 'T' has been transformed to an 'U', U standing for the compound Uracil. The diagram below shows the interpretation of the RNA code.  When a cell follows the RNA code 'book' it 'knows' exactly which of the 20 essential amino acids the machinery should add to an elongating protein as it is being synthesized (or made). It is an absolutely amazing system which too many people take for granted when they study the secrets of biology.

​

The image below shows God's wheel of RNA codes. It's the 'wheel' God's organisms use. Scientists discovered it but God invented it!

For example, reading from the centre, the triad AUG codes for the amino acid Methionine. On the DNA the corresponding code reads ATG, a 'T' for the 'U'. When the genetic machinery reads along the RNA to make the proteins essential to living cells, and it comes along the triad AUG the machinery knows that this is where the first code for a different protein starts. AUG is special in that it is known as a start codon. You will notice, that there is redundancy or built-in safety in the code. For example, whenever the amino acid Serine is required in a protein it will be coded for by either UCU, UCC, UCA, or UCG. If it reads the triad UAU, instead of UCU, a Tyrosine amino acid is added instead to the extending protein chain.

 

 

If aeroplanes, TVs and computers are designed by wonderful engineers how much more wonderful is the designer who wrote the DNA for every living organism so that it could faithfully reproduce after it's own kind generation after generation (according to it's inbuilt instruction manual or blueprint).  God has done amazing things. In third year biotechnology I referred to DNA as having been pre-determined. It specifies in exact code language just about everything that a living cell needs.

 

Most items for purchase carry a label. The label advertises the company that owns the design – Just like a car brand, whether it is a Toyota or a Ford motor vehicle for instance. When God designed He put His name into the book of life so that we can get an idea as to who designed this book of life, our internal DNA. How has He done that you may ask?

 

The DNA code is comprised of four letters. This is the secret message that tells us that the designer is revealed in four letters. The four letters are figuratively the four gospels in the Bible, Matthew, Mark, Luke and John.

 

How does the cell read the code? The message is read in groups of three. For example AAU, or GUA, or GCC, or GCA and so on. So we have four letters, and every meaningful 'word'  on the DNA/RNA must be read in three's. This is the secret message from God that He is three persons – Father, Son and Holy Spirit. The four gospels tell us that the author is three persons, yet so harmonious in their relationship to each other that they are the ONE God, Jehova or Jahweh in the Hebrew language. I believe this by faith, because without faith it is impossible to please God (Hebrews 11:6). Even more than faith, it makes total sense because the double code in DNA and RNA could have not come about by chance by any stretch of the mind.

 

Scientists have to agree that in the underlying fundamentals of biology and physics everything depends on a pattern of three's.  If it is the case in sub-atomic physics, which it is, it means that the design of the whole universe depends on a pattern of threes.

 

This is why the Bible says that everyone can come to know the true God because He has revealed Himself in the things He created, and that nobody will have an excuse on judgment day. (Romans 1:16-22).

​

​

MY RENEWED MIND ON BEING 'BORN AGAIN'

​

When I was born again in the country town of Donald, Australia, I was 36 years old and had already  been on staff for five years as a PhD researcher and lecturer in an Australian University (to remain unnamed), and had been quickly promoted to Senior Lecturer. This in itself was remarkable timing by God. Had I become a Christian any earlier, I could have been easily dismissed from staff once I made myself known as a creationist.  Fortunately, in the 1970's to 1980's the  scientific reputation I had built up in post-doctoral research, and then as a tenured academic on teaching staff, enabled me to withstand the many conflicts caused by my open Christian witness on campus.

 

As I have mentioned elsewhere, I always hated double standards! At university, biology lecturers and professors were saying in seminars and lectures how amazing it is that nature put it all together, and yet they refused to listen to anybody who wanted to prove to them that evolution theory couldn't possibly be true. I had always naively thought that academics were searching for truth. Indeed, that was the motto of our university! To my dismay, staff were biased and wouldn't hear of any other explanation except what they were already teaching about the origins of life.

 

Conflict became a daily part of life both at home and at the university. This escalated enormously once the media brought my Christian views against evolution theory to the forefront. I made nation-wide news for a few, very exciting weeks. Newspapers delighted readers with cartoons by Leunig. The TV crew of Jennifer Byrne brought along a magnificent bouquet for my wife Milena, who afterwards entertained them with an equally magnificent meal. I was filmed walking around on campus. I am listed as a creationist by RationalWiki and appear in Who'sWho in Science and Engineering (Marquis, New Jersey, USA), and am mentioned in other data banks.

 

In another TV program, I debated my beliefs with an evolutionist Dr Michael Archer from Sydney. The 20 or so minute program  was moderated by the legendary British TV personality David Frost who had been acquired temporarily by an Australian TV Channel  under contract. It was a humbling privilege to be in the presence of such a man. The only reason I bring this up is to emphasize to our younger generation the prevailing atmosphere of the creation-evolution controversy in Australia at the time. Frost became a world figure just before our interviews.  Earlier in 1977 he gained famed through his two million dollar interview with President Richard Nixon gaining the admission from Nixon that he had acted in the Watergate scandal believing that the President could override US laws at whim. 20 of his co-workers were jailed but never the President himself. US citizens were dissatisfied because Nixon never admitted his guilt; not until Frost managed to break through during the last interview which made Frost an immediate hero.

 

I gained many adherents but also a huge number of enemies, which even included Australia's top creationists to my great surprise. They could not agree with the time-line of the Creative Week and severely reprimanded me over the phone. 24-hour days for the days of creation are still firmly embedded in the minds of many Australian Christians. This state of affairs will no doubt continue until people are willing to open themselves to the whole of the Bible and not doggedly stick to a dogma they have believed for decades. Loyalty and tradition wars against truth as was also the case in the days of Jesus.

​

​

​

​

​

​

​

​

​

​

David Frost interviewing President Vladimir Putin in 2000. Kremlin.ru [CC BY 3.0 (https://creativecommons.org/licenses/by/3.0) or CC BY 4.0 (https://creativecommons.org/licenses/by/4.0)], via Wikimedia Commons

 

I gave to an unsuspecting academic audience, in an overcrowded auditorium, evidence for deliberate design as part of my usually very popular contributions to the Annual Meeting of The Australian Society of Plant Physiologists in Sydney. I was the Society's treasurer at the time and had been co-convener for two of their previous conferences. However, I thereby lost my international standing in science and close colleagues overnight. The audience listened respectfully but could not believe their ears about what I was presenting. To 'one man', they were all evolutionists.

 

I spoke on the evidence of deliberate design in mitochondria and chloroplasts, because of the absolutely essential relationship there had to be between the biochemistry, orientation, compartmentation and asymmetry of complex protein structures, for these energy sources to be functioning at the sub-microscopic level. There was no denying that there was absolutely no possibility of chance and random evolutionary processes bringing them into being, as well as these little machines (nano-machines) having the capability to reproduce themselves and their energy manufacturing processes. This, in fact, was how the Lord initially began to bring me to Himself once I realized how marvelously they were constructed.

 

In addressing the conference, I was really sharing my personal testimony that it was through blatantly obvious evidence such as this, that the Lord brought me to Himself a year earlier. One did not need to be a rocket scientist to come to the obvious conclusion that somebody had designed these proteins. I did not say that, but that is what I was driving at throughout my talk. Afterwards, a friend and once friendly scientist, who had met and been knighted by the Queen, came over to where I stood, and with a smile gently rebuked me. Yet many scientists throughout the world have joined the club of believing in Intelligent Design. They are not threatened with dismissal, as far as I know, because their only 'crime' has been to suggest that organisms have the appearance of deliberate design. What academics really objected to about me was that I dared to suggest that the Intelligent Designer was the God of the Bible.

 

During lectures to undergraduate classes, I was not embarrassed to occasionally throw something about creation into my lectures for which I was later severely rebuked. Some students wrote to the Dean of Faculty saying that they didn't want a 'Mickey Mouse' degree from a university that had a creationist on staff. I eventually had to sign an agreement that I would never bring up the topic of creation myself. However, they gave me permission to respond if provoked by staff or students in public. The irony is that the university has a motto taken directly from the bible, “Whoever seeks shall find”. Obviously, the university doesn't want to find the truths crucial to one's eternal future.

 

One day this was indeed the case when I turned up before 500 first-year students.  They had turned on the overhead projector showing a cartoon of Noah in a wooden boat, riddled with huge worm holes and a fierce storm front approaching from the distance. They had been waiting with mirth for me to turn up to lecture. I can't remember how exactly I responded, but I briefly took advantage of the situation.

 

After many adverse letters were received by the editor of the city newspaper, and abusive phone calls to heads of departments by some members of the public and from professors at other universities, the Vice-Chancellor of the University was pressured to arrange for two Heads of Department to meet privately with me to coerce me to resign. They wanted me to resign and apply for transfer to a theological college. Prior to that meeting, I had submitted a condensed curriculum of what could realistically become a viable unit for credit at degree level. It was to do with scientific flaws in evolution theory and could have become a subject in a course on the philosophy of science. Naturally, I never received a response to that.

 

At the meeting both Professors, now sadly deceased, jokingly referred to the scriptures but I was resolved not to bow to them but to remain in my position as Senior Lecturer and not resign. I had truth on my side while they only had hopeful theories on their side, as Dr. Michael Behe so clearly demonstrates in the opening video on my website. In any case, why would a theological college want a science lecturer who had no theological training, apart from church-organised bible school?

 

One of the professors, who was always jovial  and a sheer delight at boring board meetings, accompanied me down the staircase afterwards saying, 'Charles I don't really care what you believe or say, but be prepared to take a lot of flack'. Needless to say, I quietened down somewhat after that, sensing that I had overstepped a boundary in times past. This Head of Department was a source of both comfort and conflict. I heard that he had once been a circuit preacher in England strong on repentance, hell, fire and brimstone. Unfortunately, he turned his back on Christ upon reading that Christ cursed an innocent fig tree which consequently died. My impression of academics is that most of them are actually soft-hearted and are perplexed why there is so much suffering in the world. A God of love surely wouldn't allow people and animals to suffer as much as they do!

 

During those years I persisted sharing on creation science internationally and locally, though the head of the creation science movement in Australia severely reprimanded me over the phone. Their charge against me was that I was hurting their reputation because of their long standing commitment to a 24-hour interpretation for the days of creation. I realize that for Christians who have long held these views, it will be a huge and embarrassing backward step to ever agree to a 1000-year day concept, which the whole of Scripture actually firmly supports.

 

Paul the apostle was hardened to confrontation and dissent. People didn’t appreciate the conflict when new theological concepts, challenging old ones, were introduced by Paul. Nor did many of the Jews appreciate the new concepts that Jesus preached. They preferred their old comfort zones for the sake of consensus and peace. Even in Paul's day, there were churches that preferred to retain their old doctrines as is also true of churches to this day. That is why Paul said that all of Asia had abandoned him (2 Timothy 1:15). Even the apostle Peter admitted that Paul’s new theology, though sound,  was hard to understand, ‘As also in all his epistles, speaking in them of these things; in which are some things hard to be understood, which they that are unlearned and unstable wrest, as they do also the other scriptures, unto their own destruction.’  (2 Peter 3:16). That is why Paul commended the more noble character of the Bereans in Macedonia than those in Thessalonica – the Bereans were willing to search out the scriptures, to see for themselves whether what Paul was saying was true or not. (Acts 17:10-11).

​

Through friends higher up in the system, I discovered that the university had long been investigating how they could legally sack me. Through the Lord's providential guidance,  without conscious deliberation on my part, I fortunately never used the Department's name in any of my  written materials, but only the name of the university and the School's name under whose umbrella our Department was. Furthermore, my friends testified at the confidential meetings that, although they could not agree with what I believed, they strongly believed that I had every right to share my academic objections to general evolution theory and to promote my views in the face of opposition.

​

In retrospect I am wondering whether the aggressive responses by the university and academics had anything to do with science at all. Dr Michael Denton was on the academic staff in our Biochemistry department at about the same time. He had written a book 'Evolution - A Theory in Crisis' which was well read and respected overseas. Although Dr. Denton's colleagues might have raised their eye brows about it, but I never heard any of the other academics nor the Science Faculty creating a fuss about his presence on staff. It seems to me that the root cause of their complaints about me was that I was promoting the God of the Bible as the Creator. The underlying reason for their objections, and to the objections of other academics at other universities who complained against me, might have been on account of my faith in the Bible. I visited Dr Denton in his office and after spending an hour with him I discovered that he was an agnostic and his only objection about Darwinian evolution was that it was not supported by the facts of science. That placed me into a totally different category.

​

When I was in great distress, I remember the Lord showing me a vision watching myself walking through waves with threshing sharks underneath, unable to get at my feet. I was walking on an invisible barrier just below the surface of the water, like a sheet of glass, separating me from the sharks. The analogy of academics pictured as man-eating sharks fitted the situation, I thought.

A NEW START

 

Eventually, a new Head of Department was appointed who took a much gentler course of action and I agreed to amiably disagree with the Professor. In fact, the new Professor was a breath of fresh air. He very generously supported my research work and that of my PhD students. I had become slack for two reasons:

​

Firstly, because God had been there before me, designing and creating everything, I  lost interest in scientific discovery. Nothing under the Sun was new. If God  indeed created it all, why was I wasting my time on theoretical botanical issues trying to understand how cells worked? It was that which drew me to enroll as a PhD candidate in biophysics in the first place. Over the years, many botany students had asked me the same questions about their job prospects. At university they were not teaching practical horticulture in botany, which academics felt anybody would be capable of doing, but high level theoretical botany. My usual answer to the class was therefore, that the benefit of a degree was to train our minds to think analytically and for the thrill of discovery. The actual subject matter was of lesser importance. Industry will retrain young graduates to their own needs anyway. (Of course, theoretical botany has come a long way since then, with the introduction of genetic engineering). This was why Ford Motors once offered to train me as a car assembly manager promising me great rewards and a company car. They didn’t want my knowledge of chemistry – they wanted my analytical approach to problem solving on the factory floor. I declined the opportunity.

​

I guess I sulked for a number of months. My dream of being a discoverer of new things was shattered. You may think my reaction odd, but it was very real to me at the time. As an enthusiastic scientist, I suddenly felt like a child trying to find Easter eggs somebody else had hidden. The thrill of discovery had vanished overnight. I began to throw myself into student administration and student advising to at least make myself useful apart from lecturing. My door was always open to students, and even to non-academic staff, in distress.

​

Secondly,   I no longer had the good scientific reputation I once possessed because I had joined what they perceived as the lowly rank of a creationist. Since, I had witnessed physical miracles through prayer, I didn’t care what people thought of me. Nevertheless, my ideal that mathematics, physics and chemistry could explain everything was going up in smoke. I got over it slowly, taking years to come to terms with it.

​

For a few years, I only did my job mechanically and despised my academic research. I felt like throwing my job in, but after all those years I was only suited for botanical research. I had nowhere else to go and keep drawing the same salary my family was now dependant on. I was getting too old now for Ford Motors.  I felt regret that my father never allowed me to go into the newsagency business, where I could have made a fortune overseeing sales in the city business district which was promised to me. Contracts were going to be signed. My main stall was to be erected at Flinders Street Railway Station.  Even as a newsboy in the 1950’s, I was making 50% more than my father’s weekly income and I was only  fourteen or so. About 20-30 street corners were to be placed under my jurisdiction.

​

Nobody could understand what I was going through at the age of 37. I suppose that God was dealing with my pride in a very public way and it hurt deeply. It hurt my family too, but I am now very grateful to God how He dealt with me. It changed my direction in life altogether. Now I am working for the Creator of all things, and whatever could be greater than that? God was gradually retraining me Himself!

 

I was extremely fortunate that the Director of Agricultural Biotechnology in Victoria, having no doubt heard of my plight, was indifferent towards creationism.  His attitude had a positive effect on me. He was so enthusiastic about research, especially applied research and securing money-making patents for the government. The idea of applied research suddenly appealed to me. This was beginning to sound useful – something we could truly use at last! It wasn’t theoretical botany anymore. I began to feel better about things.

​

He financially supported my students, allowing them to use his laboratories and chemical consumables which would have cost our department about AUD $9000 per PhD student per annum in those days. I became co-supervisor of the students. Naturally, this was of benefit to his organization too – getting his hands on university students to do the government’s work for free!  However, all this help was the grace of God granted to me. Together with a university  department of agriculture, I also had a project running on drought tolerance in cotton in the  tropics of  Western Australia, which pleased me at the time because of its practical significance.

During those unsettling years, I can't remember exactly when, God sent me  a brilliant young student, Kyung-Soo Kim,  with his young family from Korea. He had an impeccable academic record and already had a first-rate Masters degree in molecular biology from a top university in South Korea. This hard working student was very inventive, and salvaged both my laboratory and my reputation. Somewhere around this time in 1989, I took leave at the university's expense to be trained in viral biotechnology and protoplast culture at the John Innes Institute, UK. I started disastrously through no fault of my own because of a critical typographical error in the protocols I had been given. Who thought that could happen at a top notch research institution? Nevertheless, after recovering from that, I left Norwich with my first paper in molecular biology in the press. In total, I eventually published 45 research papers and a chapter in a book. This was not really competitive in the scientific world, but enough to keep me afloat as an academic. 

 

The efficiency of the student, who is now a medical researcher in Nebraska, meant that the laboratory became competitive though it was often hamstrung through lack of sufficient funds. While others purchased molecular kits, our laboratory had to painstakingly prepare everything manually from scratch. I found it difficult to understand why such a gifted person, as this student, would want to join my research term which suffered immensely because of my unfavorable reputation as a creationist. When asked, the student's constant answer was that, among Asians overseas, I had the reputation of being understanding and helpful.

 

The next gift was that an award-winning agricultural biochemist from Israel chose to spend six months in my laboratory to work on Johnson grass mosaic virus which caused millions of dollars of damage to sorghum crops in Queensland alone. His presence bolstered my laboratory with a greater sense of respectability. We became constant companions and a few years later, when Milena and I stayed in his home in Rehovot, Raffi Salomon and his wife Tova showed us around in Israel. Raffi was proud of his Hebrew heritage, knowing all the Scriptures, but unfortunately did not believe them.  His wife frequently used to say 'Why don't you listen to Charles?' Unfortunately, he died many years ago of cancer.

​

Professor Salomon, an expert plant virologist, was on sabbatical leave from the Volcani Institute. Quoting from the University News Bulletin, 'Professor Salomon, a .......distinguished visiting fellow......was attracted.....because of the success of .......senior lecturer and researcher, Dr. Charles Pallaghy and two of his former students in the Department, Dr. Kyung-Soo Kim and Dr. Hae-Young Oh, in developing an infectious DNA copy of the RNA that comprises the genetic code of this virus. The DNA copy has been constructed in modular forms that enable mutations in its various genes to be readily made in the laboratory and then reassembled as a virus in plant leaves under contained conditions.

 

This technique has already provided new information about the function of the genes in Johnsongrass mosaic virus.....the knowledge could be used to block the passage of the virus through the plant.

 

He said that Dr. Pallaghy's laboratory was the only place where research was sufficiently advanced for this to be done.

UNIVERSITY OVERREACTS

​

Despite our success, and the fact that we had produced genetically manipulated seeds of virus-immune maize, and that our modular DNA constructs were requested for medical research in the USA for a similar virus associated with human cardio-vascular disease (the group B coxsackieviruses), the university ordered all my DNA constructs to be totally destroyed  (See the companion article 'Satan Never Sleeps'). The university would have never dared to do this to any other scientist on campus, but I was too shocked and overpowered that week to defend my rights and preserve my inventions.  I emphasize that I was unequivocally ordered to destroy all my DNA constructs and genetically engineered materials - except for the drought-resistant clovers I and my students had developed in collaboration with others.

 

A professor at the Australian National University, one of my newer collaborators with whom a contract had not yet been signed, nor had he yet been given official permission to work on my materials (we had only come to a gentleman's agreement at this point), couldn't believe the order over the phone that he had to destroy all my materials at the ANU  as well. I refused to call him myself because I felt he wouldn't believe me in a million years, so I requested the Head of Department to ring ANU himself.

 

The technical  assistant at the ANU,  since I had no suitable technical assistance of my own, had been working on my material for already two months. It was material that I had privately asked my friend and  PhD student  (now Dr. Yi-Han Lin) to prepare  especially for this purpose. It was not officially part of the PhD program laid down to him jointly, because his co-supervisor in agriculture had never previously shown interest in our idea.  He was too practically inclined to waste time on theoretical and non-economic ventures. In any case, we were using our own department's genes. Over the years, I have since forgotten exactly what our proposal was. However, if the project proved successful, it was our intention to reveal the potential benefit to the co-supervisor who might then have been attracted to it.

 

The professor at the ANU found the early results promising. Therefore, instead of having to destroy all my materials, I should have been allowed  to retrieve them and then formalize our collaboration. There was no intention to deceive or deprive anyone. That is precisely the reason why I approached  the Department that day to discuss what I had done in private,  but no opportunity for negotiation was given - just an absolutely hateful and sudden reaction that many must have heard.

 

The violence of the outburst shocked me so much that I began to imagine that the university would sue me for all I had. It was even voiced that  ANU might patent the material themselves leaving us in the cold since I was soon to retire. I would not have been quite that foolish. In retrospect, I suspect that a component of the 'perfect storm' was motivated by the  opportunity for some to vent their pent-up anger for having had a despised creationist on scientific staff for 28 years.

​

The entire incident still reminds me of the time when Shadrach, Meshach and Abednego went into the fiery furnace ordered by King Nebuchadnezzar because they did not bow to his golden image. (Daniel Chapter 3).

​

I shall not leave the story there because there was a calm after the storm. I was treated with great kindness and respect at my retirement dinner. I was welcomed to come back for three hours per week to deliver a course to third year agriculture students which I did. Nevertheless, destroying all my materials was satanic even as was King Nebuchadnezzar's flare of temper towards his three obedient servants in his realm.

​

ON FORGIVENESS

People who have watched my brief video interview have sometimes commented on the fact that both of my chief antagonists passed away, and with them out of the picture, I managed to rebuild my academic life and research team in more comfort. I must admit that sometimes I wondered whether God stepped in on my behalf and shortened their life span,

​

'And I will bless those that bless you and curse the one who curses you. And in you shall all families of the earth be blessed'. (Genesis 12:3). God made this promise to Abraham and to his descendants.
 

At a public meeting where I testified that my Professor shouted into my office, "I will fight you and your God to the death", the host commented that God certainly took him at his word.

​

Both men, though recently retired, were still active. One remained at work in an honorary research position and the other was still playing an influential role on university boards as retired professors usually do. For the benefit of my overseas readers I need to point out that Professors in Australia are usually Heads of Departments and Faculties. They are not in the lower ranks of teaching and research staff as they might be in the United States for example.  In some institutions in the USA, anybody on teaching staff can call themselves a professor.

​

Their death changed the whole picture for me, but did I harbour ill-feelings towards them? I continued to enjoy the Dean's way of injecting witty humour into dry meetings. A couple of days before he died he was in my office, like an old friend, jovially asking me whether I could contribute any old editions of scientific text books to the university he was about to visit in Asia. I was disappointed, because of his friendly manner I thought he came to my office to discuss Jesus, but no - so he wheeled away a trolley full of my books.  I was glad to be able to give them to him and to the university in Asia.

 

I visited my former Head of Department in hospital a few days before he died and apologized, to his surprise, for all the trouble and embarrassment I had caused him. I was never vindictive that I can recall nor did I have ill feelings towards any of them who had hurt me so much,

​

'But I say to you, Love your enemies, bless those who curse you, do good to those who hate you, and pray for those who despitefully use you and persecute you, so that you may become sons of your Father in Heaven. For He makes His sun to rise on the evil and on the good, and sends rain on the just and on the unjust. For if you love those who love you, what reward do you have? Do not even the tax-collectors do the same? And if you greet your brothers only, what do you do more than others? Do not even the tax-collectors do so? Therefore be perfect, even as your Father in Heaven is perfect.' (Matthew 5:44-48).

Privacy policy:  Email addresses will be treated in strict confidence and only used for issue of News Letters  and as a login for comments on our  blogs. Subscribe below

​

 

​

 

Email: cpcreation6000@gmail.com

creation 6000

T H E  F U T U R E  O F  H U M A N I T Y  A N D  S C I E N C E

© 2018 All rights reserved.  Creation 6000

bottom of page