top of page

Wonders of Gene Structure

We all know something about genes, don’t we? We joke about them - which of our traits can we see in our children or grandchildren?  We know that eye colour, hair colour and distinctive family traits are all determined by the specific genes we were born with. We inherited combinations of genes from our parents. Both mother and father gave us a mix of copies of the genes (chromatids) they inherited from their parents. That’s the science of genetics. Having read the previous article on genes you may have already understood that each chromosome consists of a super-coiled length of DNA which codes for about 1000 genes or so.

GENES ARE PRE-PROGRAMMED LENGTHS OF DNA THAT CARRY INFORMATION

Most people think of genes as a coding sequence of a length of DNA that will mysteriously produce a protein. But there is much more to a gene than just that. A single gene can give rise to multiple specific proteins as required by the cell. How is that done?

As I will show in this article, the structure of a complete gene can be quite complex and is obviously pre-designed for its function.

HOW ARE GENES EXPRESSED? HOW ARE THEY READ BY THE CELL?

As mentioned previously, genes carry the codes or information for making particular proteins. There are about 24,000 genes on the human DNA. At given times, the genetic machinery of the cell has to select and read the particular DNA code it wants and  transcribe the information into a form (RNA) that can be read by the machines (ribosomes) that will make the protein. Therefore, the message on the DNA is transcribed into an RNA molecule, that is very different from DNA, but it carries the same information more concisely in a new 'language'. It is called messenger RNA (mRNA), because it is the message that has to be passed between the DNA and the ribosomes that will read the mRNA to produce the protein. The ribosomes cannot read the information on the DNA directly.

Gene expression therefore has a minimum of three components.

1. Identification of  the gene whose product is required at a particular time and the information that is on the particular gene in DNA format

2. Transcription of the information from DNA to mRNA format

3. The ribosome machinery then is able to use the RNA message to make the particular protein specified by the desired gene.

All three components are essential to life. DNA on its own cannot make protein. mRNA is unstable and is only made whenever required. On top of that, all three steps require the participation of other RNA and protein molecules, which I refer to as the genetic machinery of the cell. Thus we have an interdependent trilogy of DNA - RNA - PROTEIN essential to life.

INTRONS

In higher organisms, such as humans, the DNA coding sequence for a gene may be interrupted by stretches of non-coding DNA called introns. During processing, the genetic machinery of the cell will have to remove these introns and stitch the rest of the code together for it to make any sense [This is done at the RNA level of transcription if you have studied biology before, but don't worry about that]. The cell may end up with four or five bits of the coding region which have to be stitched together. Depending on how the bits are 'glued' together the end result, after having processed the messenger RNA, will be a different protein.

 

This means that a particular gene may be able to make a multiple number of different proteins each different. How does the cell know which bits to stitch together and which bits to ignore? It will all depend, of course, as to which of the proteins are required at that moment. The organism 'knows' what it wants at any particular time. This is another mystery of developmental biology that will become standard knowledge someday when, unfortunately, it will no longer be a mystery and will be taken for granted. But who designed the whole system in the first place and who designed the intricate bits of genetic machinery that will perform it according to requirements?

CHROMOSOMES

To repeat, each chromosome consists of a single length of supercoiled DNA which codes for about 1000 genes or so. We have 22 pairs of chromosomes one from our father and one from our mother in each pair. There is a 23rd pair called the sex chromosomes which determine our sex. Again, one inherited from the father and one from the mother. If we inherit an XX set we become girls and if XY we will turn into boys. We need to remember that X and Y chromosomes do not have to look like an X or Y. An X chromosome can have the appearance of a diminutive Y chromosome - see the diagram below:

Human chromosome 7

The chromosome with yellow bands in the diagram is called a chromatid and consists of a short arm and a long  arm of a single length of DNA all tightly wound upon itself, which incorporates  special proteins called histones. They are compacted into their typical chromosome or chromatid shapes when the cell is about to divide or has divided. The histones act as spools, called nucleosomes, around which the DNA is tightly coiled. Nucleosomes somehow play a role in gene regulation. The yellow stripes indicate the position of genes on a chromatid of interest to the researcher who made the diagram for publication in his/her scientific publication.
  
When a cell is about to divide each chromatid replicates and forms a doublet of itself, with the two bits joined together near the middle, making them look like an X or a Y, joined  by a ‘knot’ called the centromere. The original chromatid and its new copy will be pulled apart when the cell divides into two.
 
It really doesn’t matter whether you understand this or not. What I want to focus on here is what the fine structure of DNA looks like for any one of the genes on the chromatid. It will be a segment perhaps 2000 letters or bases long looking something like this ……TAGGGGTTCCACACACCCAA…etc. What I want to tell you about is the amazing information that these 2000 bases (letters) or so carry apart from the amino acid sequence that the protein is to be made of. As you continue to ponder about all this pre-coded information on genes I am begging the question as to where all this highly intelligent information came from in the first place.

Scientists don’t know where the first set of genes came from. That would explain the origin of life or organisms capable of self-reproduction, wouldn’t it?

 

ALLOCATION OF PROTEINS TO DIFFERENT PARTS OF THE CELL

Genes are allocated in segments along a long stretch of DNA. Each of the 19,000 to 24,000 genes in humans codes for the different types of proteins necessary to construct a human body. It’s like considering a complex machine that has a multitude of different components. During assembly, not all the components are required at once nor are they all required at the same place. As in an auto assembly plant, the components are kept at different stations along the assembly line.  It wouldn’t do to have bolts meant for the carburettor to be handy in the section that is assembling the dash board. There would be utter chaos. The same applies to living cells. The gene products are sequestered into different compartments as needed.


Much of the code on each gene is there for a reason other than prescribing the type of protein to be made. Let me illustrate:

Imagine that you have a faulty appliance at home (which could represent a particular organ in your body). A component (a particular protein in our analogy) is needed and you send off a mail order to the spare parts department. The manufacturer will need information on what to send you and to where.  You will need to specify the following along with your order:


·         whether it’s a refrigerator, dishwasher or a reverse cycle heater
·         the exact model number and part number
·         the colour of the item, if applicable
·         your bankcard details so that its paid for (the energy cost to the cell and what type of the different energies available were  used - gas, oil, electricity or natural gas)
·         your name
·         your street
·         your house and apartment number
·         the suburb and postcode
·         the country in case of an international purchase
·         whether the component is to be sent by express or regular post
·         the manufacturer may automatically insure the item and package it to avoid damage during transit and, of course, charge for it as well.

Believe it or not, apart from the code necessary to specify the protein, the remainder of the gene DNA carries all this information for most genes. You didn’t know that?


I loved teaching this to my 3rd year students at university. They were gobsmacked at the implications. Who or what put all this pre-programmed information on the DNA?


GENE REGULATION AND GENE EXPRESSION

Let’s have a look at a typical gene that plays an important role in people. There are several different variants of the gene. The protein it codes for is the enzyme alcohol dehydrogenase (ADH). Its' high level in the liver and stomach lining detoxifies alcohol by breaking it down, but an excess of the breakdown product can damage our cells and add to our weight. Young women have lower levels of ADH than men of their age and, therefore, get tipsy earlier, but the reverse is true for the middle-aged. So be careful who you are drinking with.

In clover plants, the enzyme makes the plant resistant to short-term waterlogging such as when the sprinkler is left on for too long. Since waterlogging prevents roots from obtaining oxygen from air they can’t burn their sugars for the energy required to keep the plant alive. Instead, they will be forced to go down another track and convert sugar to alcohol to get a little bit of energy that way. Otherwise the plants might die as orchardists have found out. Plants don’t normally use this biochemical pathway otherwise the cells would die from alcohol poisoning; so plants need a way to switch the gene on or off according to whether they are waterlogged or not. The gene is not expressed or remains ‘silent’ under normal aerobic conditions in the soil. That’s why gardeners have to ensure that their soils are well drained for oxygen to get to the roots, but also have good texture to hold the water that’s required.

Yes, you have already guessed what I will introduce next. There is a sensor that measures oxygen concentration. If the roots lack oxygen the expression of ADH increases significantly. Its expression is also increased in response to dehydration, to low temperatures and to a plant hormone called abscisic acid, synthesised in root tips. The ADH gene plays an important role in fruit ripening, seedling and pollen development as well. Therefore the DNA of the gene is pre-programmed with regions that are sensitive to these stimuli and, not only that, but the gene is only stimulated in certain tissues such  as shown in green stain in the section cut along a clover shoot (below). The protein is not being produced elsewhere, but exactly where required.

 

What does pre-programming mean to you?

Myb promoter activity in clover vascular tissue

Questions that render biology mysterious

 

What are the specific segments of letter sequences in the DNA that enable the ADH gene to respond in these favourable ways and who or what put the information there in the first place? AND that is not all!!

As we have said before, the DNA itself can't make protein. The DNA code has to be converted to an RNA code which can travel out of the cell nucleus and meet up with one of many molecular machines, called ribosomes, which actually constructs the complex protein using the code for 20 different essential amino acids which, in turn, have to be synthesised somewhere else.

To repeat:

 

It's no use putting DNA into a test tube and then expecting protein to appear. Firstly, it needs other complex proteins to make messenger RNA and then the ribosomes which only occur in already living cells. And that’s not all. Energy and special phosphorus compounds are required for the job to be fulfilled. That’s another complex story. If the protein is produced with an address label (i.e. where in the cell it is to be sent) then that label is snipped off before the protein does its job. The whole thing smacks of a highly designed system.

‘The fool has said in his heart that there is no God…. They acted corruptly and have worked out abominable wickedness; there is not one doing good’.  (Psalms 14:1 and 53:1).

Privacy policy:  Email addresses will be treated in strict confidence and only used for issue of News Letters  and as a login for comments on our  blogs. Subscribe below

 

 

Email: cpcreation6000@gmail.com

creation 6000

T H E  F U T U R E  O F  H U M A N I T Y  A N D  S C I E N C E

© 2018 All rights reserved.  Creation 6000

bottom of page